ООО «Лабораторная Диагностика»
ООО «Лабораторная Диагностика»  
 Главная   Новости   О компании  Каталог продукции и цены   Оформить заказ   Контакты 
Каталог продукции
  Мультиплексный анализ  
   Оборудование для мультиплексного    анализа
   · Luminex FlexMAP 3D
   · Luminex 200
   · Luminex MagPix
   Наборы реагентов для
   мультиплексного анализа
   · Определение и идентификация
     антител к HLA антигенам
   · HLA-генотипирование
   · Генотипирование антигенов
     эритроцитов и тромбоцитов
   · Онкомаркеры
   · Маркеры сердечно-сосудистых
   · Иммунология
   · Нейрология
   · Метаболизм костной ткани
   · Внутриклеточный сигналинг
   · Маркеры повреждения почек
   · Инфекционные заболевания
   · Метаболизм/Эндокринология
  Иммуноферментный анализ (ИФА)
  Клеточные технологии  
  Клиническая биохимия
  Оборудование для биохимии и
  молекулярной биологии
  Общелабораторное оборудование
  Пищевая промышленность  
  Программное обеспечение  
  Проточная цитометрия
  Рекомбинантные белки
  Репродуктивные технологии
  Сортировка клеток
  Стволовые клетки (Stem Cells)
  Цитогенетическая диагностика

/ Каталог / Мультиплексный анализ / Самостоятельное изготовление наборов

Набор микросфер MagPlex-TAG

Набор микросфер MagPlex-TAG идеально подходит для изучения однонуклеотидных полиморфизмов (SNP) и анализа экспрессии генов.

Микросферы MagPlex-TAG окрашены флуоресцентными красителями в различных соотношениях. Благодаря этому окрашиванию получают 150 различных типов микросфер. Каждый тип микросфер обладает собственными спектральными характеристиками, определяемыми по свечению красителей.

Отличительная особенность микросфер MagPlex-TAG: каждый тип микросфер содержит на поверхности специальные олигонуклеотидные последовательности (anti-tag). Anti-tag олигонуклеотиды комплементарно связываются с tag-последовательностями, которые соединены с аллель-специфичными праймерами на 5'-конце (метод аллель-специфической ПЦР - allele-specific primer extention (ASPE).

Характеристика anti-tag последовательностей

  • минимальная кросс-реактивность между anti-tag последовательностями (менее 10%);
  • содержат только три типа оснований: A, G, T (например, AGTAGAAAGTTGAAATTGATTATG);
  • длина 24 нуклеотида;
  • исключено неспецифическое связывание с "природными" последовательностями;
  • единая температура гибридизации tag/anti-tag - 37°С.

Преимущества магнитных микросфер MagPlex-TAG

  • простые стадии промывки и разделения микросфер при использовании вошера;
  • 150 типов микросфер с уникальными спектральными адресами;
  • 2 500 000 микросфер в 1 мл;
  • единая температура гибридизации - не нужно подбирать и оптимизировать условия;
  • жидкофазная кинетика реакции.

Скачать Информационный лист MagPlex-TAG (на английском языке).

Таблица соответствия спектрального адреса типа микросферы (Region) и каталожного номера (Part Number)

Красным цветом выделены микросферы, подходящие для всех систем - MAGPIX, Luminex 200, FLEXMAP 3D. Синим цветом обозначены микросферы, используемые только системами Luminex 200 и FLEXMAP 3D.

Информация для заказа

Наименование ОбъемПроизводствоМетод Кат.Номер
набор микросфер MagPlex-TAG  Luminex Мультиплексный анализ MTAG-YXXX 
© ООО «Лабораторная Диагностика»,  info@LD.ru
телефоны: +7 (495) 461-67-60, +7 (499) 348-25-72